seqann models¶
Annotation¶
-
class
seqann.models.annotation.Annotation(missing: Dict[KT, VT] = None, ambig: Dict[KT, VT] = None, seq: Bio.SeqRecord.SeqRecord = None, features: Dict[KT, VT] = None, covered: int = None, annotation: Dict[KT, VT] = {}, blocks: List[List[int]] = None, method: str = None, mapping: Dict[KT, VT] = None, refmissing: List[str] = None, exact_match: List[str] = None, exact: bool = False, structure: List[seqann.feature_client.models.feature.Feature] = None, complete_annotation: bool = False, gfe: str = None)[source]¶ Bases:
seqann.models.base_model_.Modelclassdocs
-
classmethod
from_dict(dikt) → seqann.models.annotation.Annotation[source]¶ Returns the dict as a model
Parameters: dikt – A dict. Type: dict Returns: The Annotation of this Annotation. Return type: Annotation
-
complete_annotation¶ Gets the complete_annotation of this Annotation.
Returns: The complete_annotation of this Annotation. Return type: bool
-
exact¶ Gets the exact of this Annotation.
Returns: The exact of this Annotation. Return type: bool
-
features¶ Gets the features of this Annotation.
Returns: The features of this Annotation. Return type: Dict
-
structure¶ Gets the structure of this Annotation.
Returns: The structure of this Annotation. Return type: List[Feature]
-
covered¶ Gets the coverage of this Annotation.
Returns: The covered of this Annotation. Return type: int
-
seq¶ Gets the coverage of this Annotation.
Returns: The seq of this Annotation. Return type: SeqRecord
-
ambig¶ Gets the ambig of this Annotation.
Returns: The ambig of this Annotation. Return type: Dict
-
method¶ Gets the method of this Annotation.
Returns: The method of this Annotation. Return type: str
-
missing¶ Gets the missing of this Annotation.
Returns: The missing of this Annotation. Return type: Dict
-
mapping¶ Gets the coverage of this Annotation.
Returns: The seq of this Annotation. Return type: Dict
-
refmissing¶ Gets the refmissing of this Annotation.
Returns: The refmissing of this Annotation. Return type: List[str]
-
exact_match¶ Gets the exact_match of this Annotation.
Returns: The exact_match of this Annotation. Return type: List[str]
-
annotation¶ Gets the coverage of this Annotation.
Returns: The seq of this Annotation. Return type: Dict
-
blocks¶ Gets the coverage of this Annotation.
Returns: The blocks of this Annotation. Return type: List[List[int]]
-
gfe¶ Gets the coverage of this Annotation.
Returns: The gfe of this Annotation. Return type: Dict
-
aligned¶ Gets the coverage of this Annotation.
Returns: The aligned of this Annotation. Return type: Dict
-
classmethod
Reference Data¶
-
class
seqann.models.reference_data.ReferenceData(server: <module 'BioSQL.BioSeqDatabase' from '/home/docs/checkouts/readthedocs.org/user_builds/seqann/envs/stable/lib/python3.7/site-packages/BioSQL/BioSeqDatabase.py'> = None, datafile: str = None, dbversion: str = '3310', alleles: List[T] = None, seqdata: Dict[KT, VT] = None, hladata: Dict[KT, VT] = None, featuredata=None, kir: bool = False, alignments: bool = False, verbose: bool = False, verbosity: int = 0)[source]¶ Bases:
seqann.models.base_model_.Modelclassdocs
-
classmethod
from_dict(dikt) → seqann.models.reference_data.ReferenceData[source]¶ Returns the dict as a model
Parameters: dikt – A dict. Type: dict Returns: The ReferenceData of this ReferenceData. Return type: ReferenceData
-
server¶ Gets the server of this ReferenceData.
Returns: The server of this ReferenceData. Return type: BioSeqDatabase
-
verbose¶ Gets the server of this ReferenceData.
Returns: The server of this ReferenceData. Return type: BioSeqDatabase
-
verbosity¶ Gets the server of this ReferenceData.
Returns: The server of this ReferenceData. Return type: BioSeqDatabase
-
alignments¶ Gets the alignments of this ReferenceData.
Returns: The alignments of this ReferenceData. Return type: BioSeqDatabase
-
datafile¶ Gets the datafile of this ReferenceData.
Returns: The datafile of this ReferenceData. Return type: str
-
dbversion¶ Gets the dbversion of this ReferenceData.
Returns: The dbversion of this ReferenceData. Return type: str
-
structures¶ Gets the structures of this ReferenceData.
Returns: The structures of this ReferenceData. Return type: Dict
-
structure_max¶ Gets the structure_max of this ReferenceData.
Returns: The structure_max of this ReferenceData. Return type: Dict
-
hlaref¶ Gets the hlaref of this ReferenceData.
Returns: The hlaref of this ReferenceData. Return type: Dict
-
seqref¶ Gets the seqref of this ReferenceData.
Returns: The seqref of this ReferenceData. Return type: Dict
-
blastdb¶ Gets the blastdb of this ReferenceData.
Returns: The blastdb of this ReferenceData. Return type: str
-
struct_order¶ Gets the struct_order of this ReferenceData.
Returns: The struct_order of this ReferenceData. Return type: Dict
-
feature_lengths¶ Gets the feature_lengths of this ReferenceData.
Returns: The feature_lengths of this ReferenceData. Return type: Dict
-
hla_names¶ Gets the hla_names of this ReferenceData.
Returns: The hla_names of this ReferenceData. Return type: Dict
-
kir¶ Gets the kir of this ReferenceData.
Returns: The kir of this ReferenceData. Return type: bool
-
hla_loci¶ Gets the hla_loci of this ReferenceData.
Returns: The hla_loci of this ReferenceData. Return type: List[str]
-
server_avail¶ Gets the server_avail of this ReferenceData.
Returns: The server_avail of this ReferenceData. Return type: bool
-
search_refdata(seq, locus)[source]¶ This checks to see if a sequence already exists in the reference data. If it does, then it’ll return the known annotation.
Returns: The Annotation of associated with the input sequence Return type: Annotation Example:
>>> from Bio.Seq import Seq >>> from seqann.models.reference_data import ReferenceData >>> sequence = Seq('AGAGACTCTCCCGAGGATTTCGTGTACCAGTTTAAGGCCATGTGCTACTTCACC') >>> refdata = ReferenceData() >>> matched_annotation = refdata.search_refdata(sequence, locus)
-
seqrecord(allele, locus)[source]¶ Gets the Annotation from the found sequence
Returns: The Annotation from the found sequence Return type: Annotation
-
seqannotation(seqrecord, allele, loc)[source]¶ Gets the Annotation from the found sequence
Returns: The Annotation from the found sequence Return type: Annotation
-
classmethod
Blast¶
-
class
seqann.models.blast.Blast(failed: bool = None, match_seqs: List[BioSQL.BioSeq.DBSeqRecord] = None, alleles: List[str] = None)[source]¶ Bases:
seqann.models.base_model_.Modelclassdocs
-
classmethod
from_dict(dikt) → seqann.models.blast.Blast[source]¶ Returns the dict as a model
Parameters: dikt – A dict. Type: dict Returns: The Blast of this Blast. Return type: Blast
-
match_seqs¶ Gets the match_seqs of this Blast.
Returns: The match_seqs of this Blast. Return type: List[str]
-
alleles¶ Gets the alleles of this Blast.
Returns: The alleles of this Blast. Return type: List[str]
-
failed¶ Gets the failed of this Blast.
Returns: The failed of this Blast. Return type: bool
-
classmethod